La Condition pavillonnaire, S.Divry

La condition pavillonnaire. Sur le présentoir de la rentrée littéraire, le titre du dernier roman de Sophie Divry fait mouche : il est de ceux qui stimulent ta réflexion, ton imaginaire et t’entraînent à feuilleter les premières pages. Leur lecture finit d’attiser ta curiosité. L’hyperréalisme des descriptions, la façon dont la narratrice s’adresse à un « tu » – dont tu comprends vite qu’il recouvre à la fois le personnage et chacun des lecteurs -, te décident à emporter ce livre plutôt qu’un autre. Tu fais bien. Tu découvres un texte fort, qui sait t’émouvoir et t’interroger. Pourtant, une sorte de gêne s’installe au fil de ta lecture… La condition pavillonnaire aurait aussi pu s’appeler « portrait d’une insatisfaite ». M.A., dont la narratrice retrace le parcours de l’enfance à la mort, s’inscrit dans la longue lignée des « héroïnes » déçues. M.A./Emma. Le parallèle entre ces deux destins de femmes est encore souligné par la citation en exergue de la deuxième partie : « Au fond de son âme, cependant, elle attendait un événement » (G.Flaubert, Emma Bovary). Car c’est bien cela l’histoire de sa vie, depuis les impatiences adolescentes dans un village isérois, pleines du désir de voir l’existence se transformer en quelque chose de grand, au quotidien minuté d’une femme active mère de trois enfants, éclairé seulement par la perspective épisodique d’un dîner entre amis. Les seuls moments d’exaltation se résument finalement aux années d’études durant lesquelles M.A. découvre la grande ville, l’amitié, le couple, puis à quelques mois d’aventure avec un amant qui, à défaut d’offrir de l’amour, redonne le goût de jouir. Dans ces rares moments, oui, la vie se hisse à la hauteur de ce qu’elle en attend. M.A. a-t-elle trop rêvé ? Pas si sûr. Au lycée, la description de « la vie idéale » dans une lettre à une...

Constellation, Adrien Bosc

Le Constellation, « nouvelle comète d’Air France », se crashe sur l’île de Santa Maria dans l’archipel des Açores le 27 Octobre 1949. Peut-être connaissez-vous l’événement pour son côté people (Marcel Cerdan, le célèbre boxeur, sommé d’annuler son billet de paquebot pour rejoindre au plus vite Edith Piaf à New-York…). Le roman d’Adrien Bosc propose soixante-cinq ans plus tard le récit complet du dernier vol du F-BAZN et de ses passagers. Un premier roman remarquable, dont on ne peut que saluer l’ambition et la maîtrise. Un essai ou un roman? L’aspect documentaire de Constellation ne saurait masquer la part laissée à l’imaginaire. Le livre alterne les chapitres consacrés au récit du vol lui-même et de courtes biographies des passagers qu’on devine partiellement romancées. Il y a les Vies illustres  de Marcel Cerdan le boxeur et de Ginette Neveu, célèbre violoniste, mais aussi toutes ces Vies Minuscules restées dans l’ombre : citons celle d’Amélie, petite ouvrière bobineuse de Mulhouse appelée à Détroit par sa marraine, directrice d’une usine de bas-nylon qui l’a désignée comme son unique héritière ; celle d’Edward Lowenstein, directeur de tannerie  fraîchement divorcé, mais fermement décidé à un ultime aller-retour pour tenter une réconciliation ; celle de Jenny Brandière, propriétaire de champs de canne à sucre qui ramène sa fille très grièvement accidentée à Cuba ; celles de ces cinq bergers basques qui émigrent pour revenir quelques décennies plus tard s’installer dans la vallée. Des bribes, des fragments d’existences qui sont autant d’épiphanies romanesques, autant de romans possibles, mais empêchés. A travers ces biographies fragmentées, Adrien Bosc construit les figures très modernes d’un romanesque sans roman. Il se détache des longs récits pour faire scintiller chaque étoile de manière presque autonome. Car c’est d’une « constellation » qu’il s’agit – Adrien Bosc ne cesse de jouer sur la polysémie du mot –...

Le Royaume, Emmanuel Carrère

Emmanuel Carrère nous livre le résultat d’un projet ambitieux : raconter les débuts hésitants d’une religion, qui ne s’appelle pas encore christianisme, après la mort honteuse de son leader mais avant sa reconnaissance internationale. C’est une somme érudite mais surtout une formidable méditation personnelle dans laquelle nous suivons le cheminement d’un homme en quête. Presque cent-cinquante ans après le « Dieu est mort » de Nietzsche, alors que le christianisme est chahuté de toutes parts, le projet d’Emmanuel Carrère aurait de quoi rebuter : 630 pages consacrées aux débuts hésitants d’une religion, marginale et subversive il y a deux mille ans, aujourd’hui adoptée par plus de deux milliards d’individus. Pari audacieux donc, mais pari réussi ! Carrère néglige Jésus, le leader charismatique qui meurt dans un quasi-anonymat, pour suivre Paul et Luc dans leurs pérégrinations au cours de la seconde moitié du premier siècle après Jésus Christ. Pas Saint Paul et Saint Luc, figés par une longue tradition hagiographique, mais Paul et Luc, tout simplement, deux hommes, inspirés et fervents, certes, mais faillibles et maladroits.  Le premier est illuminé, fanatique, jaloux et masochiste ; le second un peu tiède, tout en compromis et en euphémismes. Alors que l’auteur se présente volontiers comme « un petit bonhomme inquiet et ricaneur », « égocentrique et moqueur », trop « intelligent », il abandonne toute ironie et trouve un ton bienveillant, sans être pour autant complaisant, pour décrire « une réalité convaincante parce qu’elle est complexe, humaine parce qu’elle est multiple », selon les termes qu’il emprunte à Marguerite Yourcenar. Mais il sait de quoi il parle : il a été tenté par le catholicisme, et l’a pratiqué, trois ans durant, de la manière la plus dogmatique qui soit. Il en est revenu et se définit désormais comme agnostique. « Affaire classée alors ? Il faut qu’elle ne le soit pas tout à...

l’Amour et les forêts, Eric Reinhardt

Bénédicte Ombredanne est une femme meurtrie, harcelée par un époux pervers et manipulateur. De ce qui ressemble à un tragique fait divers, Eric Reinhardt tire un beau roman, entaché toutefois de maladresses stylistiques et de choix narratifs peu convaincants… Tout sourit cette année à Eric Reinhardt, puisque son dernier roman figure déjà dans les listes de deux prix littéraires majeurs, le Renaudot et le Goncourt. L’Amour et les forêts est en outre largement plébiscité par la critique et les lecteurs : à l’heure où j’écris, le romancier est dans le top dix des meilleures ventes. L’auteur de Cendrillon n’est pas là par hasard et a patiemment construit son œuvre littéraire dès les années 90, avec pour fil rouge les rapports concrets de l’homme avec un capitalisme aliénant. Le Système Victoria, paru en 2011, constituait en quelque sorte le point d’orgue diablement efficace de ce travail. Avec L’Amour et les forêts, Eric Reinhardt déplace quelque peu sa perspective et aborde le harcèlement dont sont victimes les femmes au sein de leur vie conjugale. S’appuyant sur des témoignages reçus, il narre la vie tragique de Bénédicte Ombredanne, professeur de français discrète, victime d’un époux manipulateur et sadique qu’elle ne sait pas quitter. Dans cette existence violente, seule son aventure, fugace et bouleversante, avec un quasi inconnu rencontré sur Meetic, représente une consolation et lui permet de toucher du doigt le bonheur amoureux. Reinhardt possède à n’en pas douter le sens du romanesque. Il fabrique une mécanique redoutable dans laquelle le lecteur est inexorablement entraîné. Pour cela, certes, il faut passer les premières pages, peu inspirées et qui nous laissent à distance. Mais lorsque l’on entre enfin dans le foyer de Bénédicte Ombredanne, on est saisi par le sentiment du tragique devant ce personnage broyé par la présence...

Blast, Manu Larcenet

Avec le Tome IV de Blast, Manu Larcenet conclut une saga atypique qui donne à voir la part sauvage et refoulée de l’homme, animal social sommé de s’intégrer ou de se perdre. Une expérience de lecture éprouvante, mais essentielle.  Il est difficile de synthétiser dans un bref article une œuvre aussi foisonnante que Blast. En ouvrant le tome 1, le lecteur est immédiatement plongé dans le vif du sujet, mais le voilà pour le moins déconcerté : les cinq premières pages se dressent, monumentales et épurées, comme un écran au sens, dans un subtil dégradé de noir et de gris, sans aucune bulle pour expliquer la situation. Une ville dans la grisaille. Un homme seul, impassible, grasse carcasse dans une pièce démesurément vide. La gigantesque tête d’un Moaï, statue de l’île de Pâques couvant l’homme de son terrible regard de pierre. Ce n’est qu’ensuite que le décor sordide d’une garde à vue se dessine. Deux flics, comme on pourrait les trouver dans n’importe quelle série policière, tantôt hargneux, tantôt cajoleurs, essayant de comprendre, comme nous. Mais l’auteur ne désire pas que l’on y parvienne. Un lourd dossier écrase Polza en garde à vue ; il en prendra pour perpète ; soit. Mais de quoi l’accuse-t-on ? Est-il coupable, ou victime de l’acharnement judiciaire ? Nulle réponse ne nous est donnée mais un avertissement  : « Il m’aura fallu attendre que mon père meure pour ne plus me satisfaire de ma minute réglementaire [de parole]. Aujourd’hui, si j’ai besoin de plus de temps, je le prends ». Vous voilà prévenus : il  faudra être patient, laisser l’intrigue au second plan, vous perdre sur la route sinueuse d’un esprit torturé, au risque de ne pas comprendre, de ne pas pouvoir trancher ni juger. A l’affût, au détour d’une case, vous pourrez glaner un vague indice, toujours...

Hommage à Jean-Claude Pirotte

Le poète et écrivain Jean-Claude Pirotte serait mort en mai 2014 Plume d’oie sur feuille blanche : j’écrivais à l’autre bout de l’Europe un mémoire sur Jean-Claude Pirotte. Appliqué et grotesque comme sont ceux qui ressentent violemment leur imposture. Il faisait froid. La nuit tombait à quinze heures. De temps à autre, la corne d’un ferry appareillant sur la Baltique secouait mes pensées engourdies. J’étais dans les brumes avec Pirotte. Dans le mirage des brumes. Sa phrase remontait en pendulant doucement dans la gorge, se déployait en coteaux et en combes puis s’affaissait sur son désespoir qui éclairait bizarrement le pavé. Ma plume d’oie sur cahier blanc manœuvrait sans inspiration les ustensiles de boucherie stylistique. De l’isotopie par là, du sujet lyrique autant que de l’énonciation…un titre pompeux : « Un chant qui toujours déchante, poétique de la Vallée de Misère, etc ». Je marchais sur des œufs, avec des grosses tatanes. Je buvais des pils insipides. Pas de vin là-haut. J’avais lu très tard, au milieu des nuits, seul ou presque dans la bibliothèque universitaire du département de romanistik, j’avais lu sa phrase sinueuse et limpide. Je voulais me faire une foi de ce poète qui vivait en poésie, qui avait marchandé aux limites du monde social avant de s’exiler en poésie : les fugues d’enfance et d’adolescence, l’avocat réfractaire, la condamnation et la cavale, l’impossible rédemption littéraire, l’inaccessible péremption des peines…Les petits poèmes presque anodins de La vallée de misère au milieu de cette fugue reflétaient en journal de bord désaxé ma propre fugue sans rime ni raison. Que foutais-je exactement là-haut ? Pourquoi Pirotte ? Je me cherchais. Je me cherchais où j’étais sûr de n’être pas. Je cherchais ce qu’était la poésie de l’époque. Je me plantais complètement. J’avais déniché le plus inactuel des contemporains, et...

Roman américain, Antoine Bello

Vlad Eisinger est journaliste au Wall Street Tribune et réalise une série d’articles autour d’un nouveau produit financier dont seule l’Amérique a le secret. Il étudie les rouages du life settlement, qui consiste à racheter les assurances-vie de particuliers en comptant sur leur décès prochain pour rafler la mise. Ce procédé est l’occasion de dérives moralement suspectes. Son terrain d’enquête est la petite ville de Destin Terrace, une bourgade de Floride où se croisent les professionnels de l’assurance, du life settlement et de simples retraités. Dan Siver, le deuxième narrateur de ce Roman Américain vit seul au sein de cette petite société, qu’il observe avec distance. Loin des combines financières, lui rêve d’écrire le prochain grand roman américain. Les personnages de Destin Terrace et la littérature sont d’ailleurs les deux sujets privilégiés des mails que s’échangent régulièrement Siver et Eisinger, bons amis depuis l’université. Le dernier roman d’Antoine Bello fait ainsi se succéder les articles de journaux, qui ouvrent chaque chapitre, les mails que s’envoient les deux compères et le récit de Dan Siver sur la vie à Destin Terrace. Son œuvre n’a volontairement rien d’un grand roman américain : on perçoit rapidement que l’enjeu pour Bello est de dépeindre, à  travers le microcosme de Floride, l’individualisme et le manque d’aspirations d’une partie de la société américaine, tout affairée à courir après les dollars et à monétiser sa propre mort. La double narration, elle, permet de prendre la mesure de cette « american way of life », alternant la description macroéconomique du life settlement et l’observation de terrain que constitue le journal de Dan Siver. Mais en dépit de sa construction élaborée, a priori séduisante, le roman est une vraie déception. Roman Amércain souffre de deux défauts majeurs. Premièrement, son intérêt repose presque exclusivement sur les procédés...

August, Christa Wolf

August est le dernier récit de Christa Wolf, l’écrivain le plus célèbre de l’ex-République Démocratique Allemande. Ses mésaventures politiques – on lui a beaucoup reproché son ambivalence face au régime communiste- ont longtemps masqué l’importance de sa voix artistique en Allemagne. Pourtant, Christa Wolf est l’une des plus grandes, et la lecture de ce bref récit peut suffire à vous en convaincre. Prenez une heure pour lire August, et vous vous plongerez pendant votre été dans Trames d’enfance ou Le ciel partagé. August a été écrit au début de l’été 2011, quelques mois avant sa mort, et ces quelques pages ont la délicatesse d’une dernière révérence parfaitement maîtrisée.  L’émotion est contenue dans un étau que la dédicace finale à son mari, l’écrivain Gerhard Wolf, réussit seule à desserrer : « Que pourrais-je t’offrir, très cher, sinon quelques pages écrites où sont recueillis bien des souvenirs de l’époque où nous ne nous connaissions pas encore ? (…) C’est à peine si je puis dire « je », la plupart du temps, c’est « nous ». Sans toi, je serais quelqu’un d’autre. Mais je ne t’apprends rien. Les grands mots ne sont guère de mise entre nous. Juste ceci : j’ai eu de la chance ». Tout ici a un parfum de crépuscule : l’auteur se demande ce qu’est devenu l’un des personnages rencontrés dans son roman autobiographique Trames d’Enfance écrit vingt-cinq ans plus tôt.  A quoi a pu ressembler la vie d’August, ce jeune garçon un peu gauche, presque simplet, croisé dans un château transformé en sanatorium peu après la fin de la guerre, et qui concevait pour elle un si étrange amour? Le récit navigue entre deux temporalités, les souvenirs déjà lointains du sanatorium et le présent d’un trajet au volant d’un car de tourisme : August a maintenant soixante-huit ans, il transporte un groupe...

Théorie de la vilaine petite fille, Hubert Haddad....

L’invention du spiritisme dans l’Amérique puritaine de la fin du XIXème… Quel sujet ! Surtout quand on sait que le maître d’œuvre de cette vaste entreprise est Hubert Haddad, le styliste délicat du Peintre d’Eventails, un auteur que l’on aime. Et pourtant, Théorie de la Vilaine Petite Fille est le grand roman raté d’un grand écrivain. On s’explique. Hubert Haddad choisit de raconter l’histoire vraie de Kate et Margaret Fox, deux fillettes de l’Amérique profonde qui, investies du pouvoir de communiquer avec l’au-delà, vont inventer le spiritisme sans même s’en rendre compte.  Quand Mister Splitfoot (« Pied fourchu »), fantôme d’un représentant de commerce lâchement assassiné dans leur petite maison, les prend en amitié, leur existence s’en trouve entièrement redessinée. Animée d’un solide esprit mercantile et appuyée par les banquiers de Wall Street, la sœur aînée, Leah, prend les deux enfants sous sa coupe et organise des séances publiques de démonstration qui se vendent comme des petits pains. Le spiritisme devient un phénomène de société qui dépasse rapidement les frontières d’Hydesville et remue toute l’Amérique. Le Vieux Continent est bientôt lui aussi gagné par la fièvre. Mais la mécanique du succès ne tarde pas à grincer, les deux jeunes filles perdent pied, victimes expiatoires de la course au progrès qui caractérise l’Amérique de ces années-là. Le libéralisme se propage à toute vitesse dans le monde du surnaturel, les charlatans les plus habiles s’en mettent plein les poches, et les sœurs Fox finissent pitoyablement. Un sujet terriblement alléchant. L’ambition est là : Théorie de la Vilaine Petite Fille a des accents balzaciens. Le roman est monstrueux, il avale les lieux, les époques, les personnages avec un appétit d’ogre. Hubert Haddad a le désir de peindre toutes les facettes de cette folle Amérique : esclavagisme, abolitionnisme, féminisme, construction des premiers gratte-ciel,...

En Ville, Christian Oster

Christian Oster est souvent présenté comme un romancier de « l’ordinaire »; certains connaissent peut-être déjà la veine très réaliste de ses précédents récits, Mon grand appartement, ou Une femme de ménage, adapté au cinéma par Claude Berri. La réédition par les éditions Points de En ville, récompensé en 2013 par le prix Landerneau, est l’occasion de découvrir ou redécouvrir cet écrivain français, et de mieux comprendre ce travail sur « l’ordinaire ». Pour commencer, n’attendez aucun dépaysement géographique. La cartographie du récit est celle de Paris, à laquelle les personnages n’échappent pas même s’ils se préparent d’un bout à l’autre du roman à quitter la capitale pour d’hypothétiques vacances. Rues, cafés, voies rapides, hôpital, tels sont les lieux récurrents de la fiction. Ne vous attendez pas non plus à côtoyer des personnages remarquables, qui sortiraient du commun et proposeraient des modèles d’existence : Jean, Georges, William, Paul et Louise sont des urbains englués, des cinquantenaires aux vies médiocres et indécises. Même ce qui les unit semble pauvre et petit. Voilà quelques années qu’ils partent en vacances ensemble, ils se considèrent comme des amis mais ignorent presque tout les uns des autres. Au fil du roman, les personnages sont pourtant touchés par des accidents de vie qui paraîtraient propices à une sincérité nouvelle des rapports. Mais non. Christian Oster ne semble confronter les uns et les autres à ces ruptures que pour montrer qu’ils ratent le coche. Le rendez-vous programmé pour rendre hommage à William, décédé quelques jours plus tôt, tourne ainsi au fiasco: « A un moment, je n’ai plus pu me contenir et je lui en demande pardon, j’ai parlé de William, j’ai dit que je pensais à William qui aurait dû être là alors que je ne pensais pas du tout à William, je pensais que...

Ethan Frome, Edith Wharton

Julie Wolkenstein n’a pas choisi de traduire Ethan Frome. Le roman d’Edith Wharton lui tombe dessus un soir d’hiver, alors qu’elle est immobilisée par une jambe cassée : comme elle, le héros éponyme est estropié du côté droit. Curieux hasard qui n’explique pas entièrement la fascination que le personnage exerce sur elle : « En commençant, j’avais oublié qu’Ethan était handicapé du côté droit, comme moi, c’était trop beau. Je me suis laissé happer par le texte que j’ai traduit d’une traite, portée par son intensité dramatique ». Edith Wharton nous a habitués aux salons new-yorkais, et les pérégrinations de la jeune Lili Chez les Heureux du monde n’ont apparemment pas grand-chose à voir avec le chemin de croix du jeune Ethan sur les cimes glacées de la Nouvelle-Angleterre. Pourtant, ce court roman atypique témoigne des mêmes tourments, des mêmes obsessions : comment échapper à la rigidité de la morale et vivre enfin ? Est-ce même possible ? A cet égard, Ethan Frome est d’une noirceur absolue : pas une once d’ironie pour colorer l’ensemble, le tableau est sans nuance, même de gris. Souvent, on pense aux heures les plus sombres de Maupassant, à toutes ses nouvelles d’un réalisme si âpre qu’elles en deviennent presque insupportables (« Première neige », par exemple).  A la fin du XIXème siècle, Ethan Frome est un jeune homme pauvre qui aime les livres et rêve de voyages. Mais ses aspirations pèsent bien peu face aux laborieuses contraintes qui sont les siennes : la vieille ferme et la scierie, douloureux héritages qui coûtent tant d’efforts et ne rapportent rien ; la femme, vieille cousine épousée au gré des circonstances, hypocondriaque sévère qui transporte sa morbidité dans chacun de ses menus déplacements. C’est une vie sans vie, une existence rugueuse, comme le décor qui l’enveloppe. Mais Ethan tombe amoureux et tout bascule...

La Disparition de Jim Sullivan, Tanguy Viel

Tanguy Viel nous prévient  dès les premières pages de La disparition de Jim Sullivan : il va écrire un roman américain, ou plutôt un roman international, en bref, quelque chose dont la résonance dépassera les frontières de l’hexagone. Parce qu’il faut bien l’avouer : « même dans le Montana, même avec des auteurs du Montana qui s’occupent de chasse et pêche et de provisions de bois pour l’hiver, ils arrivent à faire des romans qu’on achète aussi bien à Paris qu’à New-York (…). Nous avons un pays qui est deux fois le Montana en matière de pêche et de chasse et nous ne parvenons pas à écrire des romans internationaux ». Le défi est lancé : en dépit de sa franchouillardise, Tanguy Viel va essayer de voir grand. On comprend vite que cette intention est fallacieuse: La Disparition de Jim Sullivan s’apparente plutôt à une dissection méthodique et amusée des codes du genre. L’auteur choisit de se mettre en scène en train d’écrire, exhibant ainsi la mécanique du roman US avec une ironie corrosive. La phrase est longue, méandreuse, elle enchaîne les liens de subordination pour mieux souligner les soubresauts de cette conscience en plein processus de création. Tanguy Viel use et abuse de la prétérition, très utile pour faire ressortir les ficelles : « Même si je n’aime pas trop les flash-backs, je sais qu’il faut en passer par là, qu’en matière de roman américain, il est impossible de ne pas faire de flash-backs ». Le procédé est efficace, mais pas révolutionnaire. Dans les années cinquante, les écrivains du Nouveau-Roman appliquaient cette même recette pour décongestionner le roman traditionnel hérité du réalisme balzacien. Et pourtant, Tanguy Viel excelle : la petite voix ironique qui se superpose à la narration est absolument tordante, et le lecteur s’amuse tout autant que l’auteur. Espiègle...

Dans le Silence du vent, Louise Erdrich

Joe a treize ans, trois amis pour la vie, une passion sans limite pour Star Trek et les seins de sa jeune tante. Il vit sur une réserve amérindienne du Dakota du Nord, entouré d’une famille unie : le père, juge aux affaires tribales, est l’incarnation d’une paternité confiante et solide ; la mère, généreuse et aimante, a le don de sacraliser le moindre événement du quotidien. Au-delà des frontières de ce cercle intime, il y a tous les autres : l’oncle pompiste, alcoolo notoire à la trempe facile ;  la fameuse tante Sonja, plantureuse jeune femme, objet de tous les fantasmes adolescents ; les grands-parents, grabataires déglingués, dont la lubricité n’a d’égale que la joie de transmettre et de raconter ; et puis tous les autres, les cousins, les parents, les frères des amis, personnages hauts en couleur qui assument tous leur part de responsabilité (ou d’irresponsabilité…) dans la vie du jeune garçon. Toute cette smala vivote plutôt joyeusement dans les limites étroites de la réserve. Pas de misérabilisme de mauvais goût : ici, on n’est pas plus malheureux qu’ailleurs. Pourtant, le drame survient et renverse tout. Un soir, la mère de Joe est agressée : sauvagement battue et violée, elle doit à son seul sang-froid d’échapper à l’immolation. Enfermée dans le mutisme, elle tait le nom de son bourreau. Le père tente de répondre à cette violence par les armes qui sont les siennes : il participe aux maigres investigations, recueille des témoignages, revisite tous ses dossiers, formule des hypothèses. Mais toutes ses tentatives se heurtent à un hiatus juridique : si tout semble désigner le même homme, le procès ne peut s’ouvrir tant qu’on ne connaît pas l’endroit exact du crime. Or, l’agression s’est produite dans les environs de la Maison-Ronde, haut lieu de la réserve qui accueillait...

En finir avec Eddy Bellegueule, E. Louis

Edouard Louis, 21 ans, normalien, jeune homme délicat et bien mis dont le discours bourgeonne déjà de références littéraires et philosophiques, n’est pas un héritier comme on pourrait l’imaginer. Non, lui déjoue sans demi-mesure les observations et analyses de Bourdieu, sociologue qu’il connaît bien pour avoir dirigé une étude sur son œuvre. Il n’est pas le brillant descendant d’une lignée d’universitaires parisiens mais l’indigne rejeton d’une misérable famille picarde. Edouard Louis n’est d’ailleurs pas Edouard Louis ; ce patronyme classique et bourgeois est celui qu’il s’offre pour sa naissance en littérature, dans une sorte d’auto-sacrement qui l’intègre à l’élite. Son nom d’origine, lui, marque sans doute possible le milieu populaire dont il est issu, si bien qu’on le croirait également inventé : Eddy Bellegueule est ainsi l’autre face d’Edouard Louis, à la fois réelle (comme identité administrative) et fictive (comme identité narrative de son premier roman). Edouard a comme on dit pris le large, coupé les ponts, largué les amarres. En finir avec Eddy Bellegueule est autant une façon de justifier cette prise de distance qu’une manière peut-être de trancher les derniers noeuds qui rattachent à cette identité passée. « De mon enfance je n’ai aucun souvenir heureux » : les premiers mots du roman annoncent la couleur. On pense à la célèbre phrase d’ouverture de Perec dans W ou le souvenir d’enfance, « Je n’ai pas de souvenir d’enfance ». Mais chez le jeune romancier, la mémoire de ce qui a été enduré est vive, précise, lancinante. Dans un récit méthodique divisé en chapitres thématiques ou chronologiques, Edouard Louis suit pas à pas le trajet de la souffrance. Il faut alors remonter aux origines car le drame d’Eddy Bellegueule est très tôt celui de l’inadaptation. Né dans un village ouvrier marqué par un ensemble de codes et...

Mon vrai boulot, Grégoire Damon

Grégoire Damon est un auteur lyonnais à l’écriture directe et corrosive. Son inspiration n’émane pas plus des saintes chapelles de la poésie qu’elle ne descend du ciel; elle remonte au contraire de l’autre source où se renouvellent les littératures : la ville, la rue, toute la matière cruelle de la vie contemporaine. Mon vrai boulot, le titre de son recueil, donne d’abord à entendre cela : une certaine façon de tenir la chronique des tribulations d’un jeune homme de petits boulots en petits boulots. Ni triviale ni nombriliste cependant, son écriture adresse une riposte aux agressions du monde social,  lesquelles se dissimulent dans le sinistre vocabulaire de notre actualité: agence d’intérim, nucléaire, OGM, crise, fastfood, etc. Grégoire Damon exorcise d’une façon goguenarde ce kaléidoscope, ces réalités répandues dans les écrans qui infusent nos perceptions incertaines : s’asseoir et regarder la mer et regarder la mer en streaming ce n’est pas la même chose que [… ]s’asseoir et regarder un feu de bois téléchargé légalement  La lecture de Mon vrai boulot, aux éditions du Pédalo Ivre suggère que l’auteur s’est fait la main sur scène, comme de nombreux poètes d’aujourd’hui. La quatrième de couverture mentionne des « lectures-performances et des concerts rock ». De là une prosodie qui ne s’embarrasse pas d’afféteries formelles, ne cherche pas à « troufignoliser l’adjectif » (Céline), pas davantage à fonder dans une quelconque avant-garde un futur académisme. Il s’agit d’abord de répliquer au tintouin de l’époque avec les armes qu’elle nous tend. Ses mots, souvent élimés, ses sonorités métalliques. De fait, les effets de rythme de ces textes en vers libre  témoignent, plus que d’une simple influence, de l’infiltration des musiques électrisées dans la matrice d’écriture : ce ne sont pas les paroles qui comptent c’est la musique tactactactactactactactactactactac la belle mitrailleuse d’exister Il reformule là...

Réparer Les Vivants, Maylis de Kerangal

L’excellent roman de Maylis de Kerangal raconte les vingt-quatre heures nécessaires à la transplantation du cœur de Simon Limbres, jeune surfeur déjà promis à la mort par un nom évocateur des limbes. Voilà un synopsis qui peut paraître assez peu attrayant… Et pourtant, ce roman est une frappe magistrale que l’on prend en plein corps. Le roman est centré sur le cœur de Simon, pompe de la vie, mais aussi centre des émotions, régnant sur la mécanique du corps et obéissant aux circonvolutions de l’esprit. En cela, le roman ne se réduit pas aux vingt-quatre heures de la transplantation mais englobe toute la vie de Simon et toutes celles concernées de près ou de loin par son accident. L’écriture de Maylis de Kérangal décrit avec une patience de souffleur de verre toutes les émotions des acteurs de ce drame : parents, sœur, petite amie, chirurgien, infirmière, receveuse du coeur…, comme si elle mettait en lumière chacun des fragments du kaléidoscope extraordinaire de ce transfert de vie. On entre ainsi dans la vie émotionnelle de chaque personnage, leurs souvenirs, leurs plaisirs, leurs projets, leur passé : le goût de l’anesthésiste-réanimateur Revol pour les gardes, la solitude sentimentale de l’infirmière Cordélia Owl, le parcours professionnel de Thomas Rémige. C’est ainsi qu’elle ménage des moments de légèreté dans un roman d’une gravité parfois insoutenable. Une des réussites du roman tient à la proximité que l’écrivaine instaure  entre les parents de Simon et nous autres lecteurs : elle nous fait vivre ce qui se passe dans le corps et l’esprit d’une mère et d’un père qui perdent leur enfant, leur entrée dans « l’autre domaine, qui étaient peut-être celui où survivaient un temps, ensemble et inconsolables, ceux qui avaient perdu un enfant ». On suit l’effroyable  cheminement de ceux-ci entre l’annonce de l’accident...

En Mer, Toine Heijmans

Il est heureux. Après trois mois seul en mer à bord d’un petit voilier, Donald retrouve sa fille de huit ans pour la dernière étape de son périple. Maria le rejoint sur la côte danoise, et ensemble, ils font voile vers le port d’Harlingen, aux Pays-Bas, où les attend la mère de l’enfant. Deux jours de mer a priori sans risque, l’occasion de vivre une expérience entre père et fille et de raffermir les liens. Mais voilà, le ciel s’assombrit et l’orage menace. Donald n’en finit pas de tout contrôler – cartes, météo, boussoles, voiles –, surtout ne rien laisser au hasard, c’est une question de survie. Pourtant, au cœur de la tempête, Maria disparaît. Toine Heijmans expédie ce nœud essentiel dès les premières pages du roman, puis engage le récit rétrospectif des faits qui ont précédé l’accident. Il ménage à cette occasion une montée en tension impeccable, implacable, qui interroge les circonstances du drame : comment cela a-t-il pu se produire ? Qu’est-il vraiment arrivé ? On comprend bien vite que le narrateur est éreinté, à bout de nerfs, et que son témoignage n’est peut-être pas très fiable. La tension grandit au fur et à mesure que l’on fait connaissance avec ce personnage déboussolé, irresponsable, parfois même irrationnel. Le lecteur connaît l’issue, il aimerait  bousculer Donald, le faire réagir, mais  celui-ci s’enferre, tel une souris blessée qui, à grands coups d’indécisions, de revirements, de trajets incohérents, de fausses pistes, tenterait vainement d’échapper au chat. L’auteur sème lui-même des avertissements, dont Donald évite soigneusement de tenir compte. Comme ce pêcheur ivre qu’il compare pourtant au clochard qui, dans Moby Dick d’Herman Melville, conseille à Ismaël de ne pas monter dans la baleinière. « Only God Knows » (« Dieu seul le sait ») répond le pêcheur quand Donald le questionne...

Operation Sweet Tooth, Ian McEwan

Dans une longue interview accordée à François Busnel pour le magazine Lire, Ian McEwan affirmait récemment : « La vraie force d’un roman réside dans sa capacité à représenter le paysage intérieur d’un personnage ». Dans le cas présent, celui de Serena Frome, héroïne et narratrice du dernier roman du Britannique. Contrairement à McEwan dans Operation Sweet Tooth, nous ne ferons pas durer le suspense : son dernier opus, sans être un pensum intolérable, n’a pas l’étoffe de ces grands romans où l’on quitte à regret les personnages et leurs « paysages intérieurs »… C’est au mieux divertissant, au pire vain. Pourtant, l’affaire s’annonçait plutôt bien : McEwan dépeint, au travers de la belle Serena, l’Angleterre des 70s’ tiraillée, comme la protagoniste d’ailleurs, entre un conservatisme de bon aloi et une soif de liberté mal dégrossie. La narratrice, jeune anglaise bien sous tout rapport, doucement rebelle et naturellement conformiste, rencontre Tony Canning, un ancien du MI5, les services de renseignement britannique. Celui-ci, à l’issue d’une période idyllique de formation amoureuse et intellectuelle, lui obtient un poste subalterne au sein de l’agence. Après quelques mois de travail de secrétariat, elle se voit confier une véritable mission, Sweet Tooth, dont l’objectif est de favoriser l’émergence et la diffusion d’auteurs favorables à l’idéologie du bloc de l’Ouest. Elle fait ainsi la rencontre de Tom Haley, un écrivain prometteur selon les critères du MI5, dont elle tombe éperdument amoureuse, au point de compromettre sa mission et sa carrière. Force est de reconnaître que le projet de MacEwan est ambitieux. Naviguant entre roman d’espionnage, roman d’amour et récit d’apprentissage, il brosse le portrait d’un Etat anglais morose, angoissé par son déclin, soucieux de contenir les assauts terroristes de l’IRA et l’invasion des idées marxistes, usant de la force mais aussi d’une forme de soft power qu’illustre l’opération Sweet...

La Vie qu’on voulait, Pierre Ducrozet

Le roman de Pierre Ducrozet suit en quatre temps le parcours de cinq individus, Eva, Lou, Théo, Quentin et Manel, qui ont partagé leur jeunesse dans un Berlin « d’arrière-salles ». Leur passé, nébuleux, fragmentaire, de toute évidence sulfureux, les a séparés mais ils restent liés par ce qu’ils ont vécu. Cette jeunesse est condamnée dès le début par les personnages eux-mêmes. Mais avec la première partie, Retour de flamme, elle s’impose à nouveau sur le devant de la scène comme quelque chose de mal guéri. Le roman démarre ainsi avec le retour de Manel, le seul qui semble être allé jusqu’au bout de leur folie adolescente et s’y être perdu pour toujours. Les autres ont fui dans un avenir conventionnel qui n’en satisfait pourtant aucun ; Manel revient comme un scrupule dans les chaussures trop bien vernies de ses anciens compagnons de route. Leur inconfort fondamental, ironiquement souligné dès le début du roman, devient aussi le nôtre : les personnages se sont accommodés d’un morne quotidien, admettant que leur lutte enfantine contre le monde comme il va – fadeur, vanité, médiocrité – n’était pas moins vaine que celle d’une mouche dans un verre de vinaigre. La première partie nous rend ainsi palpable cette chose inavouée, la fait grossir, génère une tension qui ne peut que lâcher, pour le pire et le meilleur, sur fond d’un quotidien sans couleur : Lou qui « fait comme si », Eva et sa machine à capsules, « [déroulant] le fil des jours comme si de rien n’était », Théo qui « a compris depuis longtemps que la vie n’est pas ici », et Camille alias Quentin alias Sean qui se cache sous les masques d’une mythomanie bénigne et se drape d’une subversive désinvolture. Nous pressentons rapidement que les personnages croient seulement être passés à autre chose mais qu’ils nourrissent...

La Lune dans le puits, François Beaune

Drôle d’objet que le dernier opus de François Beaune. Entre Décembre 2011 et Avril 2013, le jeune romancier lyonnais a parcouru tout le pourtour méditerranéen en quête d’histoires vraies. La Lune dans le puits est la somme de tous ces récits. L’objectif ? Construire le portrait de « ce nouvel individu collectif, né au combat sur les vases grecs, le livre de l’avocat-supporter-architecte-de-cirque-en-sable-aubergiste-au-chômage-sirène-de-call-center-gymnaste-et artisane-de-médina-délocalisée, le livre du plombier-peintre-poète-à-la-retraite-joueur-de-oud-de-tavla-fumeur-de-chicha-cireur-droguiste-conteur-cremière ». Définir en quelque sorte une identité méditerranéenne – peut-on aujourd’hui encore oser l’expression ? – au-delà des clivages politiques, religieux, culturels qui agitent traditionnellement la région. Le projet est ambitieux, voire titanesque : il dépasse en tout cas largement les contours restreints de notre petit débat national. Chapoté par Marseille-Provence 2013, Capitale européenne de la culture, il ne saurait s’entendre sans son versant multimédia : aujourd’hui, les histoires s’écrivent sans François Beaune, et ce, directement sur le site du projet. Chaque habitant de la Méditerranée peut déposer son histoire vraie dans sa langue et sous la forme de son choix (vidéo, son, texte). Fin 2013, plus de 1300 histoires étaient en ligne. Ambitieux projet, donc, dont on peut attendre le pire comme le meilleur. Le pire ? Un recueil d’historiettes bien pensantes qu’on lirait en écoutant du Manu Chao sur des coussins bariolés et qu’on refermerait rassérénés, convaincus par toute cette belle humanité. Nous sommes tous des citoyens du monde, après tout… Le meilleur ? Une mosaïque bigarrée, en reliefs et en couleurs, qui prend à bras le corps la question de l’identité.  François Beaune nous offre cette seconde version : La Lune dans le puits est un livre fin et subtil, qui propose, en filigrane, un parcours intellectuel très convaincant. Au terme de son voyage, l’auteur propose courageusement un portrait de « cet individu collectif (…) révélé par ces reflets de lune ». On peut trouver cette définition consensuelle – on vous laisse juger… – mais elle a déjà le mérite d’exister. Le projet pourrait achopper sur bien des points, mais François Beaune contourne les difficultés avec une grande finesse. Ainsi, comment traduire tous ces récits sans les trahir ? Que faire des particularismes langagiers ? Comment retranscrire la parole du boxeur algérois ou de l’homme de la haute société du Caire ? L’auteur choisit  d’homogénéiser l’ensemble, alors qu’il aurait pu tenter de retranscrire l’oralité des uns et des autres. Paradoxalement, ce lissage linguistique donne plus de charge émotive aux histoires, elles sont lancées au lecteur comme des pierres brutes. Cette atonalité facilite l’identification du lecteur qui vibre sans qu’on se joue de lui : oui, La Lune dans le puits est un livre intense, qui serre le ventre et fait briller les yeux… On est saisi par l’histoire poignante de ce petit artiste juif qui meurt d’avoir sculpté le dernier repas d’une famille juive, alors qu’un officier allemand lui a commandé une reproduction de la Cène ; on s’émeut de la tentative désespérée d’un village palestinien pour vivre en autosuffisance, lors de la première Intifada, alors que des troupes israéliennes  s’acharnent à tuer leurs vaches cachées dans le maquis ; on est attendri par ce jeune aviateur sicilien qui a l’habitude de jeter dans les airs son sac de linge sale pour que sa mama le récupère… Reste alors à soulever la question la plus délicate: François Beaune est-il ici l’auteur de La Lune dans le puits ? Peut-on lui accorder l’autorité d’une œuvre qui n’est, pour une large part, qu’une collecte de récits ? La question est d’autant plus pertinente que le projet navigue aujourd’hui sur la Toile en complète autonomie. C’est pourtant bien à lui seul qu’il faut tirer notre chapeau. D’abord, parce qu’il est responsable du tri, de l’agencement – selon les âges de la vie, de l’enfance à la mort – et de la réécriture. Ensuite, parce qu’il dispose au cœur de l’œuvre des éléments très personnels. Ces digressions sont d’ailleurs un peu foutraques : reconnaissables par l’italique, elles empruntent tout autant à l’autobiographie qu’au récit de voyage, au reportage qu’au texte poétique. Se...

Au Revoir là-haut, Pierre Lemaitre

Novembre 1918. La guerre touche à sa fin, mais il faut encore survivre à d’inutiles massacres. Le lieutenant d’Aulnay-Pradelle a besoin d’une dernière bataille pour parfaire son prestige avant que la guerre ne se termine. Pour motiver ses troupes, il tue lâchement deux de ses soldats, « un coup des Boches », pense-t-on dans la tranchée. Le soldat Maillard découvre la supercherie. Enterré vivant dans un trou d’obus dans lequel Pradelle l’a poussé, il est sauvé in extremis par Edouard Péricourt. L’un d’eux finit salement amoché. Puis, c’est la démobilisation. Comment survivre dans une société faite pour la paix, quand on est seul, défiguré, morphinomane et désespéré ? Comment retrouver goût à la vie ? En montant une arnaque culottée, un formidable doigt d’honneur à la « Patrie reconnaissante ». Le roman de Pierre Lemaitre, lauréat du Prix Goncourt 2013, fait immanquablement songer au Voyage au bout de la nuit de Céline ou aux dessins de Tardi. Albert et Edouard sont frêles, pleutres, effarés, paumés. Ces antihéros typiques se contentent d’abord de subir leur triste sort. Mais les gueules cassées de la Grande Guerre, au sens propre pour l’un, se rebellent en montant une combine imparable, escroquant les mairies, la population, la Nation tout entière, jouant du sentiment patriotique et exploitant le deuil jusqu’à l’os. Voilà une idée forte que cette vengeance absolue contre « l’arrière », contre la Patrie. Une vengeance teintée d’anarchisme qui pointe du doigt l’hypocrisie du Souvenir et méprise la pitié suscitée par les poilus revenus de l’enfer. Le roman, et c’est sa grande force, paraît donner la parole à deux macchabées revenus de la guerre, décidés bon gré mal gré à faire payer les vivants. Albert et Edouard sont liés par une touchante amitié dont les fondements – loyauté, morale – sont en complète contradiction avec l’époque...

Décompression, Juli Zeh

Lanzarote est une île paradisiaque, aride et sauvage, un soleil intense luit sur les facades blanches des demeures canariennes. Un lieu idéal pour Sven, ancien étudiant en droit reconverti en moniteur de plongée, dont le but, en s’y installant, était d’échapper à la société des hommes, à leurs jugements permanents. En quittant l’Allemagne, Sven a emmené avec lui Antje, sa compagne qui l’assiste à plein temps dans son entreprise de plongée touristique. Libéré des engagements du monde, baragouinant vaguement l’espagnol, Sven mène donc une vie retirée, tout entier absorbé par son activité sous-marine. L’arrivée de Theo et Jola, couple glamour et sensiblement perturbé, va bouleverser cet équilibre artificiel. Le dernier roman de Juli Zeh est un thriller psychologique dont la franche réussite tient d’abord à l’épaisse ambiguité du trio amoureux que forment Jola, Théo et Sven. Jola, la jeune et superbe actrice en attente du grand rôle de sa carrière, joue un double jeu dangereux. Elle aguiche outrageusement Sven mais guette en permanence les signes d’amour de Théo. Ce dernier, écrivain prometteur, est semble-t-il, en panne d’inspiration. Quant à ses pratiques sexuelles, elles témoignent d’une singulière perversité. Sven, si soucieux de rester à distance des conflits, est irrésistiblement attiré par la voluptueuse Jola ; sa volonté de désengagement est mise à rude épreuve au contact du couple. Sven est l’homme neuf, l’homme nouveau, à l’inverse de Théo, que Jola surnomme le « viel homme », tout à ses ruminations et à sa violence enfouie. Mais sa nonchalance, son calme de façade se fissurent insensiblement, à mesure qu’il s’empêtre un peu plus dans cette histoire confuse avec Jola, dont Théo est le témoin tour à tour complice et exaspéré. L’obscure tension du récit est habilement entretenue par la façon qu’a Juli Zeh de faire alterner les voix de...

Pamphlet contre la mort, Charles Pennequin

La phrase de Charles Pennequin est une foreuse, une spirale de fer qui  creuse dans la langue, tourne sur elle-même, remonte des tonnes de gravats, plâtreries, stucs, tessons de discours éculés et détruit, broie, avance, n’en finit pas vrombir, essayer d’assouvir son appétit monstrueux, une faim des choses sensibles dissimulées sous la pompe oiseuse des mots. Difficile, en conséquence, d’en citer quelques lignes significatives ;  le texte évolue par soubresauts, coq-à-l’âne et approximations qui dévident un fil de sens déchaîné. C’est dans la durée que ce jeu de déviations incessant suscite l’émergence  de blocs compacts qui font sens et emportent l’adhésion. Pour donner tout de même un exemple, le texte prend vie lorsque le paragraphe bute et renaît en s’accrochant à une suite de substantifs apparemment sans liens (cheville – chevillé – question- l’auteur- l’autre) au moment même où il décrit le surgissement de la pensée dans l’écriture : «quelle est cette pensée qui surgit dans l’écrit ? je ne le sais pas complètement, je sais qu’il y a quelque chose qui s’est déroulé, qui s’est chevillé au corps, c’est la cheville ouvrière de l’être parlant, le type qui se coltine toute la chose et dedans et qui n’est pas l’auteur en question, l’auteur en question n’est pas questionné. Il est seulement en représentation, alors que l’autre s’est tapé la chose » « Ouvrière » a également son importance. Pennequin ne travaille pas dans les limbes de la création pure. Poésie de chantier, poésie aux mains sales, poésie dans mine à ciel ouvert, cette toupie produit dans sa giration un martèlement qui s’accorde parfaitement à la rythmique givrée du monde. Il faut quelques pages pour se plier au vertige de l’écriture, puis se laisser entraîner à cette façon de forcer la langue à parler autrement – cette façon de taper...

Faillir être flingué, Céline Minard

Un western littéraire, ça vous tente ? L’entreprise est de nos jours suffisamment rare pour interpeller et il n’est pas étonnant de voir Céline Minard s’y coller, une écrivaine touche-à-tout, imaginative, peut-être l’une des plus stimulantes de ces dernières années. Faillir être flingué, c’est la saga bang bang et poétique d’une bande de cowboys solitaires qui finissent par ériger une ville autour d’un saloon. Un excellent morceau de littérature populaire, intelligent et bien écrit. Le roman croise les récits de différents personnages, tous solitaires ou presque, qui cherchent à survivre et à s’établir dans le grand ouest américain. L’occasion d’une sacrée galerie de portraits. Céline Minard juxtapose d’abord sans lien ces multiples récits, sous la forme de saynètes rapides et nerveuses qui s’enchaînent avec brio. Ainsi le vol d’un cheval, qui passe de mains en mains ; ainsi cette cérémonie mortuaire indienne qui se déploie sous nos yeux circonspects ; et ce concours d’ivrognes au saloon, à la fin duquel chacun s’affaisse, imbibé d’un obscur tord-boyau. Que dire de cette intrusion parmi des bandits de grands chemins assoupis dans le seul but de récupérer l’archet d’une musicienne ambulante ? Ces histoires entremêlées – et avec elles l’odeur de la sueur du cowboy, de sa crasse, les nuits silencieuses des grands espaces, le bruit des coups de poing, des sabots, des verres sur le zinc –  créent un panorama impressionniste de la conquête de l’ouest : Minard exploite avec succès toutes les potentialités du roman et se distingue du western cinématographique dont le format interdit un pareil foisonnement narratif. Deux  grandes époques émergent au sein de ce délicieux maelstrom. A la première partie du roman, celle des solitudes, succède le temps de la solidarité et de l’effort commun. Au-delà du plaisir élémentaire (le roman demeure un divertissement sans prétention),...

La Lettre à Helga, Bergsveinn Birgisson

La Lettre à Helga de Bergsveinn Birgisson a tout pour plaire : une couverture flatteuse, une forme épistolaire plaisante, un décor scandinave attirant. L’histoire d’amour annoncée possède un réel potentiel romanesque : Bjarni, berger des côtes du Nord-Ouest de l’Islande, tombe amoureux de sa voisine, la plantureuse Helga. Tous deux sont mariés. Dans ce monde clos sur lui-même, il ne leur reste qu’une alternative : renoncer à l’amour ou quitter la terre natale. Un roman pastoral à la sauce islandaise, voilà bien quelque chose qui devrait nous tenir chaud cet hiver. On le dit d’ailleurs assez dans la presse, qui célèbre d’une voix presque unanime ce nouveau prodige de la littérature scandinave. Pour autant, il n’y a rien de miraculeux dans La lettre à Helga. Le roman est tout au plus agréable. Seul l’arrière-plan présente un réel intérêt, mais celui-ci est finalement moins littéraire qu’ethnologique. L’auteur échappe à l’écueil du pittoresque de pacotille, et on peut lui reconnaître un véritable talent dans l’écriture patrimoniale.  Ainsi, on apprécie vraiment  quand Bergsveinn Birgisson oublie son histoire d’amour et  se laisse aller à l’anecdote, qu’on devine dénichée aux confins de la mémoire collective. L’épisode du rapatriement du corps de Sigridur Holmanes est, pour le coup, un vrai petit miracle. Le narrateur et l’un de ses compagnons se rendent sur une île perdue dans le Nord du pays pour récupérer la dépouille d’une vieille femme afin qu’elle soit enterrée à l’Eglise. Mais au moment de repartir, ils l’oublient là-bas. Par malchance, l’hiver est si tenace qu’ils ne peuvent y retourner qu’au printemps. Quel stratagème va donc inventer le mari de la vieille pour préserver le corps de la décomposition ? Il va sans dire que l’invention est savoureuse… On devine que cette histoire est de celles qu’on se raconte le soir,...

Canada, Richard Ford

La lecture de Canada de Richard Ford est un pur moment de jubilation. En cinq-cents pages, l’écrivain américain construit une épopée grandiose dans l’Amérique et le Canada des années soixante. Le lecteur avale les chapitres avec une facilité déconcertante, qui tient à la fluidité de l’écriture et à un remarquable sens du rythme. L’ensemble est drôle, caustique, mais aussi profondément intelligent. Canada fait partie de ces trop rares romans qui nous divertissent autant qu’ils nous élèvent. Dell Berner, aujourd’hui professeur à le retraite, revient sur une période cruelle et insensée de sa jeunesse. Tout commence à Great Falls, Montana, trou montagneux, austère et glacial. C’est là qu’a débarqué la famille Parsons, à la faveur d’une énième mutation du père, pilote dans l’armée de l’air. Le couple parental est mal assorti : le père, grand gaillard charmeur, se distingue par sa gouaille et son accent du Sud ; la mère, binoclarde et pâlotte, est introvertie et hostile au monde. Leurs enfants, Berner et Dell, sont des adolescents solitaires, repoussés à la marge pour avoir été trop souvent déracinés. Au terme d’une étrange dégringolade, les parents braquent une agence de l’Agricultural National Bank, dans l’état voisin du Dakota du Nord. L’opération est un flop, ils sont rapidement identifiés et emprisonnés. Les jumeaux sont alors livrés à eux-mêmes. La première partie du roman, peut-être la plus réussie, décrit cette lente déchéance avec un mélange de cynisme et de tendresse. Le narrateur nous raconte, par le menu, la dérive hallucinée de ses parents, braves gens que rien ne prédestine à une telle fin, loin s’en faut. Dell tente rétrospectivement de trouver des explications à tout ce carnage, mais celles-ci restent toujours à inventer. La réussite de ce début de roman tient largement à cette énigme irrésolue : si Richard Ford évoque le...

Rien, Emmanuel Venet

« L’énigme d’une vie ratée » : voici la formule qu’utilisait Emmanuel Venet, psychiatre lyonnais, pour évoquer le destin de Gaston Ferdière, poète méconnu et médecin réprouvé d’Antonin Artaud qui faisait l’objet de son précédent opuscule (Ferdière, psychiatre d’Antonin Artaud, 2006). C’est le portrait d’un autre anti-héros, fictif cette fois, que propose Rien, premier vrai roman de Venet : ce portrait, c’est celui de Jean-Germain Gaucher, compositeur de troisième ordre à la Belle Epoque, qui a fini ruiné, alcoolique et écrasé par son demi-queue Pleyel dans sa cage d’escalier. Ou plutôt, ce sont deux existences ratées qui se superposent dans le livre : la vie de Gaucher se déroule en effet à la faveur d’un monologue intérieur du narrateur, qui lui a consacré la totalité de ses recherches en musicologie et à qui il a fini par s’identifier au point d' »hypothéquer son identité ». Comme le compositeur à qui il a consacré sa vie, l’universitaire n’a pas eu de carrière prestigieuse – et pour cause. Ce glissement entre les deux personnages se fait dès les premières pages : en effet, si le narrateur a emmené sa compagne Agnès à l’hôtel Negresco à Nice, c’est moins pour célébrer les 20 ans de leur rencontre dans une tentative de raviver la flamme que pour suivre inexorablement la trace de Gaucher, qui y avait séjourné avec sa maîtresse. Ce début de roman est ainsi habilement programmatique : en avouant au lecteur les raisons de ce faux voyage en amoureux, qui n’est en fait qu’un prétexte à son pélerinage personnel,  le narrateur met d’emblée en avant le thème essentiel de la désillusion amoureuse. Venet lève le voile sur la « fiction de l’amour », qu’entament les petites et les grandes trahisons, l’érosion du temps et l’enlisement de la vie conjugale. Le narrateur, qui...

Il faut beaucoup aimer les hommes, Marie Darrieussecq...

Marie Darrieussecq│Il Faut beaucoup aimer les hommes │ P.O.L │ 2013   Nous avions toutes les raisons du monde d’entrer à reculons dans le dernier roman de Marie Darrieussecq : la pente intellectualiste propre à P.O.L, le titre hommage à Marguerite Duras, patronage pour nous plus irritant que rassurant, la quatrième de couverture, à la limite du ridicule (« Une femme rencontre un homme. Coup de foudre. L’homme est noir, la femme est blanche. Et alors ? »)… Sans parler des vieilles accusations de plagiat qui ont émaillé par deux fois la biographie de cette docteur es Lettres, psychanalyste de surcroît. Néanmoins, la grande simplicité de cette histoire avait quelque chose d’attirant : Solange rencontre Kouhouesso à Hollywood, où elle exerce le métier d’actrice. Ils ont une histoire, puis se séparent. Le livre ne dépasse jamais les bornes de ce récit, vieux comme la littérature. Dès les premières pages, le roman met en avant la couleur de peau de l’amant. Kouhouesso est noir. Et de cela, Solange ne se remet jamais vraiment. Elle imagine, sous le grand corps d’ébène de l’homme qu’elle aime, l’exotisme de ses origines, une manière différente  de penser le monde ; bref, une radicale étrangeté. Mais cette couleur de peau n’est que le symptôme d’une altérité bien plus grande. En effet, jamais Solange ne semble à même de saisir son amant, d’en comprendre les absences, les agacements, la distance puis les étreintes torrides. Tout le long du livre, la protagoniste attend son homme, espère qu’il va venir au bout de la nuit, patiente en voyageant, via Google Map, au cœur de l’Afrique, où elle pense dénicher son coeur. Elle est prête à le suivre au bout du monde, au bout surtout de son rêve à lui : filmer une nouvelle adaptation d’Au Cœur des ténèbres de...

Le Rire du grand blessé, Cécile Coulon

Cécile Coulon, éd. Viviane Hamy, 2013, 136 pages Avec Le Rire du grand blessé, la toute jeune romancière Cécile Coulon s’essaie à un genre romanesque marqué par George Orwell ou Ray Bradbury. Comme ses célèbres prédécesseurs, elle imagine une société totalitaire et aliénante contre laquelle un homme enfin se dresse, mû par l’espoir fou d’un autre horizon pour l’humanité. On connaît la chanson, maugrée-t-on au fil des pages : bien sûr, la littérature est attaquée par le système ; on s’en doute, le personnage le plus acquis au pouvoir est précisément celui par qui la révolte arrive. Le scénario reste donc des plus classiques, même si, au final, l’auteur évite la simple redite. Un roman de science-fiction, d’anticipation? Cécile Coulon ne goûte pas ces classifications rapides. Ni robot fou, ni navette intersidérale dans ce monde qu’on ne peut dater précisément. C’est une société que le récit décrit, sans créature ou événement surnaturels. Une vaste organisation appelée « Service National » y est chargée d’appliquer un Programme à l’origine médical. Lucie Nox, médecin travaillant avec des toxicomanes, a un jour expérimenté avec succès le postulat suivant : ses patients se droguent car leur vie ne leur permet pas d’exprimer des émotions profondes, mais s’ils peuvent par la lecture accéder à ces émotions et les extérioriser, ils n’auront plus recours aux substances incriminées. Le pouvoir, incarné par un fantomatique « le Grand », perçoit dans ce protocole de soins un moyen de contrôler l’ensemble de la population. Il organise, avec la complicité plus ou moins forcée du docteur, une catharsis régulière par la lecture, visant à libérer hommes et femmes de leurs pulsions. Pour ce faire, le livre est entièrement repensé : l’ancienne littérature est détruite et des « Maisons de Mots » déversent des romans à sensation unique : Livre Frisson, Livre Haine, Livre Tendresse… Des...

L’Esprit de l’ivresse, Loïc Merle

Les émeutes des banlieues de 2005 n’ont à ce jour pas beaucoup inspiré les romanciers. Il est vrai que la tâche n’est pas facile : en se risquant à en faire son thème central, comme le fait Loïc Merle avec L’Esprit de l’ivresse, l’écrivain investit le terrain politique et son œuvre devient forcément polémique. Pour cette seule raison, on applaudit déjà la volonté de s’attaquer à un tel sujet et de sortir du nombrilisme cher à de trop nombreux jeunes auteurs français. L’œuvre s’en trouve extrêmement stimulante et mérite d’être lue. Si la référence aux événements de 2005 est évidente, le roman demeure une fiction : une émeute éclate dans la cité des Iris en banlieue parisienne et se propage à toute la France, au point de provoquer la fuite du président de la République, Henri Dumont. Pendant un temps, Paris est aux mains des révoltés et on assiste à un printemps des peuples semblable à la Commune de Paris de 1871. Le roman n’est pas une simple narration des événements, mais une confrontation des expériences de quelques personnages-clés. Au gré de leurs pensées, de leurs souvenirs épars, le lecteur reconstitue de lui-même la chronologie des faits. Ce procédé permet surtout de sonder l’âme des protagonistes, de faire l’inventaire de leurs motivations, de leurs contradictions, de souligner la complexité des enjeux qu’on est souvent tentés de réduire à des préjugés. Le récit de la première nuit d’émeutes aux Iris propose une interprétation très manichéenne qui laisse craindre le pire : les émeutiers sont absolument pacifistes et répondent à des policiers idiots, agressifs et violents, sous le regard de journalistes en mal de scoop et de sensations fortes, qui se rangent du côté des oppresseurs dès que leur intégrité physique est menacée. Le point de vue narratif court...

Arrive Un Vagabond, Robert Goolrick

Le premier chapitre d’Arrive Un Vagabond donne le ton : en affirmant la véracité des faits en dépit de l’ambivalence du souvenir, le narrateur inscrit le roman dans le cadre de la tradition romanesque la plus éculée.  Le récit de Robert Goolrick ne joue pas la carte de la subversion, loin s’en faut.  Pourtant, ce classicisme fait du bien : porté par un je-m’en-foutisme salvateur, le romancier ne se prive de rien et nous offre un roman d’amour délicieux. A l’heure où l’on mesure les œuvres à leur degré d’ironie, Arrive Un Vagabond est une belle surprise. La trame du roman est très convenue : voici la sempiternelle histoire de l’étranger débarqué par hasard dans une petite ville aux mœurs étriquées, comme il en existe tant d’autres aux Etats-Unis après la Seconde Guerre mondiale. Une ville avec son épicerie générale, son boucher, un coiffeur, une banque ; une ville dans laquelle les gens ont pour projet de vivre paisiblement, de mourir et de monter au paradis l’heure venue. Obnubilés par le salut, ils tiennent les péchés à distance et conservent une certaine rigueur morale. Mais survient le vagabond, avec ses deux valises, l’une remplie de couteaux de boucher, l’autre d’une importante somme d’argent. Charlie Beale, dont le charme le dispute à la bonhomie, séduit peu à peu les habitants de Brownsburg. L’adoption est presque signée quand se produit le drame : Charlie Beale s’éprend de Susan Glass, petite poupée de dix-sept ans, blonde et aguicheuse, mariée à un riche propriétaire, insupportable barbon qui fait régner la terreur sur sa femme et sur la communauté. De cette union naîtra le sublime et l’horreur. La passion entre les deux personnages naît comme une évidence. La description du coup de foudre est tellement stéréotypée qu’on se croirait dans un pastiche d’un roman du...

Fugitives, Alice Munro

L’équipe des Heures Perdues est heureuse d’apprendre que le Prix Nobel de littérature 2013 a été décerné à Alice Munro. Voici l’article que nous lui consacrions il y a trois mois.  Alice Munro est une nouvelliste canadienne saluée dans toute la littérature anglo-saxonne. Joyce Carol Oates, Jonathan Franzen ou encore Cynthia Ozik la considèrent comme la digne héritière de Raymond Carver. Elle figure même depuis plusieurs années sur la liste des nobélisables. Elle reste cependant relativement méconnue en France, ce qui est fort regrettable,  quand on considère l’étendue de son talent. Quand on découvre les nouvelles d’Alice Munro, on retrouve des émotions de lecture oubliées : d’abord la surprise, parfois même la déroute, parce que la nouvelliste défie l’art de la narration et chute là où elle le désire, sur un non-dit, un vacillement, un moment de doute. Ensuite, une forme d’empathie supérieure, qui ne se résume jamais à une simple identification aux personnages, mais qui maintient au contraire une distance féconde qui nous oblige à juger notre propre existence. Enfin, l’ébahissement, parfois, tant la langue s’avère d’une beauté mystérieuse. Il y a en effet quelque chose qui relève de la magie dans cette écriture : le lecteur, bien qu’avisé, n’est pas en mesure de repérer les astuces qui permettent à la nouvelliste d’atteindre ce degré d’émotion, et c’est là ce qui tient, à mon avis, du prodige littéraire. Fugitives – Runaway est le titre original- relate les destins de huit femmes tentées par la fuite. Happées par un ailleurs possible ou simplement imaginé, quelque chose hors de leurs vies, hors d’elles-mêmes, elles sont le plus souvent empêchées d’aller au bout de leur désir, ou intimement impuissantes à y parvenir. Elles hésitent, tergiversent, mentent, se mentent, abdiquent, renoncent. Carla, par exemple, préfère sa vie de couple...

Une Dernière Fois la nuit, Sébastien Berlendis...

Vaincu par l’asthme, un homme s’éteint progressivement, recroquevillé dans le lit naufragé d’une maison à l’abandon. C’est la fin d’un long chemin. Il arrive d’Italie après avoir retrouvé les lieux qui ont constitué sa mythologie personnelle : la maison natale de Bracca, petite tache parmi les pins sombres, dont l’atmosphère étouffante favorise l’épanouissement de la maladie ; San Pellerino, lieu de la première cure, des premiers soins pour modérer les crises, et de la naissance de l’amour ; la villa Luigia au bord du lac de Côme, dans laquelle l’amour est porté à son comble, jusqu’à l’agonie, puis la mort ; Trieste, le réconfort apporté par la mer et le soleil, la joie des autres corps…et enfin la maison du dix, chemin de la Résistance, sur le plateau d’Assy, cette dernière nuit. On devine que ces pérégrinations sont moins géographiques que mentales : l’homme se remémore, et le lecteur perçoit les traces de ces souvenirs au sein d’un jeu de reprises et de variations qui donne à l’ensemble l’allure d’un vaste poème en prose. La lecture est envoûtante, on se perd dans ce récit comme on se perdrait dans la contemplation d’un vieil album de famille. Dans sa forme discontinue, le récit se rapproche d’ailleurs de l’album : les blocs de texte sont les photos qu’on a délicatement collées sur l’espace blanc de la page. On les imagine en noir et blanc, parce que c’est ainsi que l’auteur souhaite nous raconter le parcours de cet homme dans cette Italie du Nord du début du siècle. Certains passages semblent envahis par un blanc solarisé, d’autres font la part belle au noir qui, dans sa dureté, crée d’émouvants effets de contraste. Ce jeu entre le noir et le blanc, tant sur la forme que sur le fond, exprime tout le paradoxe du...

Le Temps, le temps, Martin Suter

En Suisse, au pays des horlogers et à la ponctualité proverbiale, nier l’existence du temps est un comble. C’est pourtant ce à quoi travaillent Peter Taler et le vieux Knupp dans le dernier roman de Martin Suter, Le Temps, le temps. Le titre résume bien la quête obsessionnelle des deux protagonistes pour abolir le passage des ans. Peter Taler a perdu sa femme, assassinée un an plus tôt et depuis, le temps s’est arrêté pour lui : il reproduit inlassablement les derniers moments de la dernière soirée avant le meurtre de Laura. Quant à son voisin Knupp, son ambition, qui ne lui vaut au départ que mépris et ironie de la part de Taler, est de supprimer toutes les modifications qu’a subi son quartier depuis la mort de sa femme, de le restaurer dans son état d’origine et ainsi, d’abolir la disparition de Martha Knupp. Peter Taler va peu à peu s’investir dans l’impensable projet de son voisin en échange d’informations sur le meurtre de sa compagne. Deux questions sont donc supposées tenir en haleine le lecteur : qui a assassiné Laura Taler ? La folle entreprise de Knupp a-t-elle une chance d’aboutir ? Il faut rendre grâce aux premières pages du roman qui distillent une certaine étrangeté. Une sourde inquiétude émane de ce quartier sans histoire dans lequel on espionne ses voisins et où un drame s’est produit un an auparavant. Mais au fil de la lecture, le roman, à l’instar de cette banlieue suisse qu’il décrit, devient monotone, ennuyeux et perd le sel de ces pages initiales. Volontairement, Suter reste très en surface de ses personnages et ne fait guère dans la psychologie. Mais ce parti pris se retourne contre lui, car in fine, il reste bien peu d’éléments auquel le lecteur...

Le Peintre d éventails, Hubert Haddad

Dans son dernier récit, Hubert Haddad imagine un lieu singulier et envoûtant retiré à l’extrémité d’une île japonaise, une auberge des âmes en peine recueillie entre montagnes et Pacifique. Dame Hison, ancienne courtisane, dirige cette pension du bout du monde où gravitent des hôtes permanents et occasionnels, qui trouvent dans cette « province de l’oubli » le charme du secret ou le soulagement du retrait. Parmi eux, Osaki Tanako, jardinier et peintre d’éventails. Retiré de la grande Histoire après le suicide de ses parents au moment de l’armistice, Osaki n’a plus quitté Atora, rivé à l’espace clos du jardin ou de la feuille de soie, emporté dans une « danse permanente entre l’atelier et l’enclos enchanté ». Il a répondu à la perte et aux effondrements de toutes sortes par le développement d’un art précaire et modeste, recourant aux matières les plus fragiles, tentant par les formes les plus ténues d’esquisser une impression de beau ou de vérité. Ainsi a-t-il passé une vie à faire dialoguer estampes, haïkus et perspectives végétales. Pourtant, bien qu’humble parmi les humbles, n’a-t-il pas aussi cru pouvoir se protéger du monde et le maîtriser dans les paradis clos qu’il a forgés ? L’art d’Osaki échappe au néant en s’inscrivant dans une transmission. Le vieux peintre est devenu un maître en se choisissant un disciple, Matabei Reien, lui aussi en quête de disparition dans les brumes d’Atora. Plus tard, après la mort du maître, Matabei transmet à son tour l’œuvre à Xu Hi-han, apprenti cuisinier de la pension. Mais le fil est apparemment coupé lorsque le chaos frappe de plein fouet le jardin protégé : sous la forme du désir d’abord, qui sépare maître et disciple séduits par la même femme, puis sous la forme d’un accident nucléaire qui, en même temps qu’il dévaste toute la...

Une Fille, qui danse, Julian Barnes

Comment continuer à vivre lorsque les vérités sur lesquelles on a fondé son existence s’effritent soudainement ? Telle est la grande question posée par le nouveau roman de Julian Barnes. Six ans après Arthur et George, l’écrivain anglais revient avec Une Fille qui danse, récit plutôt habile d’une enquête, d’un travail de “corroboration” du passé qu’entreprend le protagoniste à l’occasion d’un étrange legs… Anthony Webster est le narrateur de ce roman constitué de deux parties distinctes. Dans la première, il raconte les “souvenirs approximatifs” d’une frange de son adolescence lycéenne durant laquelle il fait la connaissance d’Adrian Fynn, un jeune homme mystérieux, plus brillant que lui et ses deux amis proches, Colin et Alex. Il y raconte aussi sa rencontre avec Veronica Ford, son premier amour, vaguement calculatrice et hautaine, du moins dans son souvenir. Suite à leur séparation, elle se met en couple avec Adrian, qui se suicide quelques temps après. La véritable habileté du récit tient à sa seconde partie, qui est une relecture, quelques cinquante ans plus tard, de cette adolescence : le jeune Tony est devenu Anthony Webster, marié-divorcé, père et grand-père, un vieil homme qui mène une retraite paisible, vaquant à l’entretien de sa maison et à ses activités bénévoles. Il hérite par la mère de Veronica Ford du journal intime de son ancien ami Adrian. Aiguillonné par le possible contenu de ce document, il décide de le récupérer auprès de Veronica, qui refuse de le lui remettre. A cette occasion, il va revisiter son passé, découvrir combien le temps a altéré ses souvenirs et à quel point il s’est aveuglé sur son histoire personnelle. Roman sur le passage du temps, sur les failles et les illusions de la mémoire, Une Fille qui danse bénéficie d’une construction romanesque ambitieuse...

14, Jean Echenoz

Anthime, Charles, Padioleau, Bossis et Arcenel, cinq jeunes hommes originaires de Vendée, sont happés par la Première Guerre mondiale. Certains en reviendront invalides, d’autres mourront. Restée au pays, Blanche est une jeune femme dont la vie est liée à deux d’entre eux. Que peut donc ajouter Jean Echenoz à ce qui a déjà été écrit sur l’immense charnier de la Grande Guerre ? Rien, de toute évidence. Et il paraît vain d’entamer ce roman avec un semblable horizon d’attente. 14 est un récit court, efficace, précis, qui ne s’embarrasse pas d’inutiles descriptions de l’horreur des tranchées, et qui ne cherche pas non plus à développer le point de vue ni la psychologie de ses personnages. Tout est fait dans 14 pour que seuls les faits implacables demeurent et entraînent avec eux, et pour eux seuls, l’effroi et la compassion des lecteurs, comme s’il était obscène de s’appesantir sur l’évidence de l’horreur, de l’expliciter et de la boursouffler. Pari réussi. Pas de longues descriptions, donc, mais pas d’hyperboles non plus, ni d’artifices poétiques quels qu’ils soient. Pas de narration complexe ni de pathos. Mais on s’attache, on est bouleversé, horrifié. Ainsi, Anthime, le personnage principal, répond à l’appel avec indifférence, sans enthousiasme ni crainte. Le récit de sa prise d’information au son du tocsin est un modèle d’épure. Plus loin, le récit de la désertion inconsciente d’Arcenel suit le même processus. A chaque fois, le style d’Echenoz reste simple et s’en tient aux faits. Lorsqu’un personnage est découpé par un éclat d’obus, la même ascèse est respectée. L’évocation de l’invalidité d’un personnage, amputé d’un bras, révèle cette aptitude du roman à émouvoir dans la sobriété. Echenoz nous interdit l’accès aux pensées de l’infortuné. C’est différemment qu’il parvient à nous apitoyer, par une évocation bouleversante de ses...

Tigre! Tigre!, Margaux Fragoso

Quand Margaux fait la connaissance de Peter, elle a sept ans, lui cinquante et un. Ils se rencontrent à la piscine municipale. Devenue adulte, elle se rappelle son air enfantin, malgré les cheveux gris et les rides, au coin des yeux et de la mâchoire. Peu après, Peter invite la mère et la petite fille chez lui. Margaux découvre un joyeux capharnaüm : un jardin luxuriant, des animaux dociles, des malles pleines à craquer, remplies de déguisements et de jeux.  Peu à peu, les habitudes s’installent et toutes deux reviennent très régulièrement. Chez Peter, on bronze, on s’éclabousse, on engouffre des hot-dogs dégoulinants, et surtout, on invente des histoires, reprises et variations du même scénario dont on est, bien sûr, toujours l’héroïne. Margaux adore venir chez Peter, « parce que Peter est comme elle, juste plus grand, et qu’il peut faire des trucs qu’elle ne peut pas faire ». Dans le préambule au roman, Margaux Fragoso rapporte les propos d’une gardienne de prison rencontrée à l’occasion d’un reportage: « Passer du temps avec un pédophile est comme un shoot de drogue. C’est comme si les pédophiles vivaient dans une sorte de réalité fantastique, et ce fantastique contamine tout. Comme s’ils étaient eux-mêmes des enfants, mais pleins d’un savoir que les enfants n’ont pas. Leur imagination est plus puissante et ils peuvent bâtir des réalités que des petits enfants seraient incapables de rêver. Ils peuvent rendre le monde… extatique, d’une certaine façon. Quand c’est fini, pour ceux qui sont passés par là, c’est comme décrocher de l’héroïne, et pendant des années ils ne peuvent s’empêcher de poursuivre un fantôme, le fantôme de ce que ça leur faisait ». L’intérêt de ce récit autobiographique réside précisément dans le traitement de cette ambiguïté : le crime a souvent des allures d’histoire d’amour ; dans cette histoire,...

Peste et choléra, Patrick Deville

Peste et choléra est une biographie romancée du microbiologiste Alexandre Yersin, personnalité originale de la « bande à Pasteur », découvreur du bacille de la peste et explorateur du sud-est asiatique. Tout l’intérêt de l’œuvre de Patrick Deville repose sur le fait que, malgré l’ampleur de ses découvertes et de sa personnalité, Yersin reste relativement anonyme en France. Dès lors, le travail de Deville s’apparente à une réhabilitation, doublée d’une méditation progressive sur le génie et la postérité. D’abord scientifique de renom, Yersin fuit une prometteuse carrière parisienne au sein de l’Institut Pasteur dont il est l’un des membres les plus brillants, pour mener l’aventure dans le sud-est asiatique. Il s’y fait médecin à bord d’un bateau de liaison pendant deux années, puis met pied à terre pour mener des expéditions qui ouvriront des voies stratégiques en Indochine. Découvreur du bacille de la peste à Hong-Kong, puis du vaccin et du sérum anti-pesteux, il se lance alors dans le commerce du caoutchouc et de la quinine, non sans s’être essayé à d’autres activités. Yersin finit sa vie en Indochine, lui qui fut le premier à y importer une automobile, et où il a mené jusqu’à sa mort une vie d’anachorète craintif, de nabab avant-gardiste et de philanthrope adulé. De bout en bout, Patrick Deville propose un voyage captivant dans lequel histoire et médecine s’entrelacent sur fond d’exotisme et d’aventure. Le genre de la biographie romancée, choisi par Patrick Deville, est  plaisant, mais n‘est pas sans soulever quelques problèmes. Car c’est une manière de piller allègrement de la matière clé-en-main dans la vie d’un homme, tout en s’assurant la fascination du lecteur, laquelle découle de l’authenticité des faits. Cependant, ce genre permet de s’affranchir de la rigueur propre à l’historien, de passer sous silence ce qui lui...

Certaines n’avaient jamais vu la mer, Julie Otsuka...

Lorsqu’on leur offre la possibilité de quitter leur pays et la pauvreté dans laquelle elles survivent, ces jeunes femmes japonaises n’hésitent pas. Elles embarquent pour l’Amérique avec leur kimono, leur savoir-faire de cuisinière, leur bon sens de paysannes, leur quant-à-soi pour les plus privilégiées. Elles viennent avec leur croyance (généralement bouddhiste), leur innocence, leur endurance – qui leur sera bien utile. En effet, instrumentalisées par des agences matrimoniales peu scrupuleuses, elles déchantent aussitôt arrivées : les hommes qu’elles épousent sont des brutes épaisses auprès desquels elles mèneront une vie de misère. Prolétaires ou non, toutes seront soumises aux mêmes brimades, au même mépris, au même désenchantement : « Nous comprenions que jamais nous n’aurions dû partir de chez nous ». Après Quand l’empereur était un dieu, roman inspiré par l’histoire de son grand-père suspecté de trahison après l’attaque de Pearl Harbor et interné pendant trois ans, Julie Otsuka renoue avec ses origines pour raconter le trajet de ces femmes japonaises, de leur arrivée sur le port de San Francisco aux camps d’internement une vingtaine d’années plus tard. Ce petit livre poignant, très singulier, a été acclamé aux Etats-Unis avant de l’être en France : aujourd’hui auréolé du Prix Femina Etranger 2012, il caracole en tête des ventes depuis quelques semaines. Ce succès est aisément compréhensible : non seulement la romancière met en lumière un fait historique méconnu – la déportation des populations japonaises pendant la seconde guerre mondiale-, mais elle le fait avec une virtuosité époustouflante. Ce court roman se divise en huit chapitres aux titres éloquents – de l’ironique  « Bienvenue, mesdemoiselles japonaises ! » au tragique « Disparition ». Dans l’intervalle de ces cent-cinquante pages, le lecteur est confronté à un vaste mouvement de dégradation, de la désillusion à la disparition. C’est la mémoire de tout un peuple qu’il s’agit alors de reconstruire, peuple...

Home, Toni Morrison

Depuis une dizaine d’années, les romans de Toni Morrison évoluent vers plus de concision, mais ne se départissent jamais de leur puissance d’évocation. C’est le cas de Home, son dernier roman : moins de cent-cinquante pages sont nécessaires pour décrire l’atmosphère de l’Amérique des années 50 et raconter le destin d’un frère et d’une sœur noirs, jetés dans le bain du racisme et de la ségrégation. Le roman s’ouvre sur un bref poème, dans lequel le narrateur se prend à rêver d’une maison  différente de celle dont il a la clef : « J’en ai rêvé une autre, plus douce, plus lumineuse / qui donnait sur des champs traversés de bateaux peints/ sur des champs vastes comme des bras ouverts/pour m’accueillir » ; et il se ferme sur deux phrases laconiques, isolées au sein du dialogue : « Viens, mon frère. On rentre à la maison ». Entre les deux, dans l’espace laissé par cette centaine de pages, Toni Morrison construit le trajet de Franck et de Cee, à la recherche de cette maison, de ce refuge. Comme le titre l’indique, le roman est le récit de cette quête : trouver un chez-soi, un abri, une sécurité, qu’elle soit matérielle ou symbolique. Dès le début du roman, le narrateur évoque un exil : celui de la famille de Franck et Cee, jetée sur les routes par des individus « à la fois avec et sans cagoule ». Déracinée, condamnée à l’errance, la famille trouve un semblant de refuge dans la petite ville de Lotus où habitent déjà les grands-parents, Lenore et Salem. Tous se partagent d’abord douloureusement la même maison. Puis, au prix d’efforts considérables, les parents parviennent à acheter leur propre bicoque. Cependant, étouffés par cette ville « sans trottoirs ni canalisations intérieures », les enfants fuient, Franck en Corée, Cee à Atlanta, avec « la première créature...

L’Histoire de Pi, Yann Martel, Ang Lee

Pi, jeune indien affable et farfelu, a la chance de naître au zoo de Pondichéry, propriété de son père. Vivre au milieu d’animaux de toutes espèces n’a rien d’anodin, et Pi développe très vite une curiosité et une aptitude au relativisme assez exceptionnelles. Notre jeune héros s’enthousiasme  ainsi simultanément pour la religion bouddhiste, musulmane et catholique. Il mêle croyances et enseignements, rites et interdits dans un joyeux mélange de toute bonne foi : pourquoi croire à une seule religion à l’exclusion de toutes les autres ? La vie est douce dans la tiédeur du zoo, et Pi pourrait grandir ainsi, de découvertes en découvertes, et devenir un adulte fantasque, certes, mais confiant et équilibré. Il en ira tout autrement : à la suite d’incidents politiques dans le pays, le père de Pi choisit de s’exiler, embarquant sa famille et la plupart des membres du zoo sur un cargo japonais en direction du Canada. Hélas, le bateau fait naufrage et Pi est le seul humain à en réchapper… seul humain, oui, car au fond du canot de sauvetage est tapi Richard Parker, énorme tigre du Bengale, que Pi connaît déjà bien pour l’avoir vu gloutonner une chèvre avec la même facilité que lui-même avale un naan au fromage. Durant 227 jours, Pi devra oublier sa faim, sa soif, sa peur et tenter coûte que coûte d’apprivoiser l’animal, avant que celui-ci ne se décide à en faire son repas. La sortie de l’Odyssée de Pi de Ang Lee était l’occasion de se plonger dans le roman du canadien Yann Martel, que l’on avait raté à sa sortie : sept millions de lecteurs, quarante-deux traductions, Man Booker Prize, autant de raisons de se pencher sur un succès aussi retentissant. Certes, L’Histoire de Pi répond aux codes les plus fameux du roman d’aventure....

Qu’avons-nous fait de nos rêves ?, Jennifer Egan...

Je l’avoue, j’ai choisi de lire ce roman parce que j’ai été attirée par une campagne de presse efficace, présentant ce roman comme « une perfection absolue » (dixit le New-York Times, excusez du peu). Evidemment, le fait qu’il soit auréolé du prix Pulitzer a achevé de me convaincre. Pourquoi évoquer ainsi les raisons qui ont déterminé cette lecture ? Parce que j’ai eu l’impression, encore une fois, de m’être fait balader. En dépit de tous ces éloges, voilà un roman décevant: à trop vouloir en faire, on s’égare. Le roman de Jennifer Egan appartient à cette littérature américaine de l’après-11 Septembre qui dessine le visage sombre et anxiogène d’un pays rongé par un mal protéiforme : désastre écologique, libéralisme ravageur, perte des valeurs… La romancière choisit d’évoquer les désillusions existentielles de la génération des ex-seventies. Elle raconte les destins d’une myriade de personnages  gravitant tous plus ou moins autour de l’industrie du disque et fait du passage à l’ère numérique le point de départ d’une méditation sur le temps qui passe et qui emporte avec lui les rêves. Ainsi, Bennie, ancien punk passionné, devenu producteur de tubes insipides, rendus exsangues par les effets de la conversion numérique : « Bennie savait qu’il fabriquait de la merde. Trop limpide, trop aseptisé. La précision, la perfection, voilà le problème, elle vidait de substance tout ce qui se prenait dans les rets microscopiques de son système ». Pour rendre sensible ce sentiment de déclin et le contraste entre rêves et réalité, Jennifer Egan use de techniques romanesques empruntées tout à la fois aux feuilletons du XIXème siècle et aux séries télévisées contemporaines. Imitant la structure des sopranos, elle fait des allers retours constants entre les deux personnages principaux, Bennie et Sasha, et les personnages secondaires qui déambulent autour d’eux. Elle se refuse à toute...

Le Sermon sur la chute de Rome, Jérôme Ferrari...

Marcel Antonetti naît au lendemain de la première guerre mondiale, benjamin d’une famille de six enfants. Devenu fonctionnaire et en partance pour l’Afrique de l’Ouest française, il juge convenable de se marier avant d’exercer ces nouvelles fonctions. Ce sera une jeune fille du village corse dont il est originaire qui lui donnera un fils, Jacques, et mourra en couche. Marcel, incapable d’élever seul ce fils, le confie à sa sœur, Jeanne-Marie, elle-même mère de Claudie. Les cousins germains, Claudie et Jacques, se marient, malgré la répugnance de leurs entourages et de leur union naissent deux enfants, Aurélie et Matthieu. Ce dernier, étudiant en philosophie à Paris, ne rêve que de revenir en Corse, qu’il imagine être son pays. Il profite de l’opportunité de reprendre le bar du village pour s’y installer avec son meilleur ami, Libéro. Après quelques mois où tout semble fonctionner pour le mieux, ce nouveau monde que Matthieu et Libéro ont fondé se détraque, s’abîme, jusqu’à la tragédie finale. Ce résumé, déjà fort long, ne rend pas compte de la densité d’un roman qui ramasse, en tout juste deux cents pages, un récit familial à travers lequel les mondes passent, s’effondrent, attendent de se lever. Cette densité est encore lestée par les références à l’époque de Saint Augustin, lui qui a témoigné de la chute de l’Empire Romain. La grande force du roman, sa puissance dramatique, tient précisément au fait que Ferrari fait peser sur ce microcosme, ce bar minable et héroïque, tout le poids de ces efforts humains passés pour (re)créer des mondes : l’histoire de Marcel, cousue en parallèle à celle de son petit-fils Matthieu, fait déjà état de cet effort, voué à l’échec, de s’inventer une existence, un destin, lorsque l’on vient après la Grande Guerre, après la grande...

Les Désarçonnés, Pascal Quignard

Les Désarçonnés est le septième tome de Dernier Royaume, œuvre à part entreprise en 2002. Ensemble foisonnant qui se propose de sonder l’âme humaine, relevant tout à la fois de l’essai, du conte, de la poésie, de la note de bas de page, de la méditation philosophique, de l’anecdote ou de l’article anthropologique, Les Désarçonnés est un texte exigeant, difficile, parfois abscons. Un sentiment ambivalent se crée à sa lecture : si des pierres d’achoppement, relevées ci-après, irritent, consternent parfois, il demeure un grand texte que l’on prend plaisir à parcourir. On peut reprocher à Pascal Quignard d’écrire une somme  anti-médiatrice, résolument tournée vers lui-même. L’auteur semble réclamer avec fermeté que le lecteur le suive mais il paraît signifier à chaque page que lui ne se retournera pas. Ce repli sur soi – Quignard revendique d’ailleurs une anachorèse lettrée en fin de volume – reste néanmoins une facilité intellectuelle. Quignard laisse vaquer ses méditations sans contrainte et se refuse à tout effort de mise en forme, de constitution de sens pour autrui : son texte est fragmentaire, multiplie les ellipses, tait les liens logiques, juxtapose les pensées et manie l’implicite. En somme, les Désarçonnés s’apparente à un brouillon sublime. Outre la difficile création de sens qu’il suscite, ce tome balaye d’un revers de la main tout un lectorat dépourvu de culture dite « légitime ». Car le propos de Quignard est constamment déduit, suggéré ou illustré par une référence à la culture classique que Pierre Bourdieu nomma « légitime » et dont il étudia le rapport de domination qui en émanait, ainsi que la violence symbolique qu’elle créait. Ainsi retrouve-t-on pêle-mêle Grégoire de Tours, Plutarque, Saint Paul, Foucault, La Boétie, Freud ou encore Nietzsche. Le problème ne se trouve pas tant dans la référence elle-même – toujours judicieuse et éclairante...

Petite table, sois mise!, Anne Serre

Ce titre enchanteur est un clin d’oeil à un conte des frères Grimm, dans lequel il suffit au personnage de prononcer cette formule magique pour voir sa table se couvrir de mets délicieux. Anne Serre place donc son dernier roman dans la tradition littéraire du conte, pour évoquer le parcours en trois temps d’une fillette qui, marquée par une enfance incestueuse, deviendra écrivain. La première partie du roman, dans laquelle la fillette une fois adulte se rappelle de la maison familiale, n’est pas sans évoquer un autre conte des frères Grimm. Lorsque Hansel et Gretel, abandonnés par leurs parents dans une forêt profonde, découvrent la maison en pain d’épices, ils pensent avoir trouvé le refuge sucré où ils seront pleinement aimés et contentés. Mais le temps est vite venu d’être décillé : pour échapper à une dévoration certaine, les petits devront s’arracher aux pièges destructeurs de l’enfance. Dans Petite table, sois mise ! la maison familiale, de même, leurre et enferme. Celle-ci n’est pas tout sucre mais tout sexe. La porte s’ouvre sur une « sylphide » brossant sa toison, le couloir mène d’un côté à l’espace ouvert de la mère, ogresse au désir jamais rassasié, de l’autre à l’antre paternelle où se dresse le vit tant convoité. Même les mots utilisés pour décrire les lieux semblent prisonniers de leur connotation sexuelle : « on y pénétrait par un jardin » avec « des bandes de gazon très court ». Trois fillettes, dont la cadette, la narratrice, sont prises dans les rets de cette circulation spatiale et sexuelle, écartelées dans leur quête de satisfaction des désirs parentaux. Pour l’enfant devenu écrivain, la maison se réduit parfois à quelques motifs hypertrophiés – immense table cirée du salon, dalles vert foncé du vestibule, tapis du bureau aux fleurs étincelantes -, résidus visuels des ébats sans...